Phenylacetyl-coa ligase

Author: vexg

August undefined, 2024

WebJul 1, 2009 · The edd mutant utilized PAA even in the presence of glucose, indicating that CCR had been abolished. This observation has additional support from the finding that there is high phenylacetyl-CoA ligase activity in the edd mutant, even in the presence of glucose+PAA, but not in wild-type cells under the same conditions. WebMay 1, 1999 · phenacyl-CoA synthetase (EC 6.2.1.30; phenylacetyl-CoA ligase), which acts on a variety of arylalkanoic acids. This list is based for the most part on the recognition of …

Escherichia coli K-12 substr. MG1655 phenylacetate degradation I …

WebMay 1, 1990 · A new enzyme, phenylacetyl-CoA ligase (AMP-forming) (PA-CoA ligase, EC 6.2.1-) involved in the catabolism of phenylacetic acid (PAA) in Pseudomonas putida is described and characterized.... WebPhenylacetyl-CoA is the sub-strate of a presumed multicomponent oxygenase, PaaABCDE. This oxygenase is a key enzyme of the pathway, proposed to be responsible for the … osce imprimir constancia rnp

Purification and biochemical characterisation of phenylacetyl-CoA ...

WebSep 1, 2007 · A novel phenylacetyl-CoA ligase gene, designated phlB, was cloned and identified from the penicillin producing strain Penicillium chrysogenum based on … WebPhenylacetyl-CoA is often produced via the reduction of ATP to AMP and the conversion of phenylacetate and CoA to diphosphate and Phenylacetyl-CoA. ATP + phenylacetate + CoA → AMP + diphosphate + phenylacetyl-CoA. This reaction is catalyzed by phenylacetate … WebJan 15, 2009 · The phl gene, encoding a PCL (phenylacetate-CoA ligase), was cloned in Escherichia coli as a maltose-binding protein fusion and the biochemical properties of … osce certificacion 2023

Insights into the molecular mechanisms of β-lactam antibiotic ...

Phenylacetate Metabolism in Thermophiles: Characterization of ...

WebDec 12, 2024 · Based on the pathway described in E. coli and Pseudomonas by Teufel et al. , phenylalanine (Phe) is degraded to PAA, and the first step of the pathway is the conversion of PAA to phenylacetyl-CoA (PAA-CoA) by the phenylacetyl-CoA ligase PaaK. The phenylacetyl-CoA thioesterase, PaaI, can reversibly convert PAA-CoA back to PAA to … Web1) In this PhAc-CoA catabolon, phenylacetyl CoA ligase (PhAc CoA ligase) (EC6. 2. 1. 30) is a key enzyme because this enzyme catalyzed the ﬁrst step, the activation of PhAc to phenylacetyl coenzyme A (PhAc-CoA). PhAc-CoA ligase genes were cloned from several bacteria species, for example Escherichia coli2) and Azoarcus evansii.3) osce ingreso con clave osce chrome

"WebJun 1, 1993 · Phenylacetate-CoA ligase (AMP forming) was found in cells grown anaerobically with phenylacetate and nitrate. Maximal specific enzyme activity was 0.048 μmol min -1 x mg -1 protein in the mid-exponential growth phase. After 640-fold purification with 18% yield, a specific activity of 24.4 μmol min -1 mg -1 protein was achieved. " - Phenylacetyl-coa ligase

Phenylacetyl-coa ligase

Bacterial phenylalanine and phenylacetate catabolic pathway

WebApr 1, 2006 · A gene, phl, encoding a phenylacetyl-CoA ligase was cloned from a phage library of Penicillium chrysogenum AS-P-78. The presence of five introns in the phl gene … WebNov 1, 2008 · The phl gene, encoding a PCL (phenylacetate–CoA ligase), was cloned in Escherichia coli as a maltose-binding protein fusion and the biochemical properties of the enzyme were characterized. The...

Did you know?

WebPhenylacetate-CoA ligase (E.C. 6.2.1.30), the initial enzyme in the metabolism of phenylacetate, was studied in Thermus thermophilus strain HB27. Enzymatic activity … WebMay 1, 1990 · PA-CoA ligase was purified to homogeneity (513-fold). It runs as a single polypeptide in 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and has a …

WebSep 28, 2024 · IPCL is homologous to phenylacetate-CoA ligase that belongs to the family of ligases that form carbon-sulfur bonds. In the presence of coenzyme A, Mg 2+ and ATP, IPCL converts isophthalate to isophthalyl-CoA, AMP and pyrophosphate (PPi). WebJun 1, 1993 · It catalyses the reaction phenylacetate+CoA+ATP → phenylacetyl-CoA+AMP+PP i and requires Mg 2+. Phenylacetate-CoA ligase (AMP forming) was found …

WebMar 6, 2024 · Having characterized the specificity and sensitivity of fungal metabologenomics at the 110-strain level, we used it to uncover a new GCF–metabolite pair. We targeted an ion with an m / z of 343.129... WebMar 22, 2007 · Analysis of the paa gene cluster led to the description of 14 putative genes: a gene encoding a phenylacetyl-CoA ligase ( paaF ), the enzyme required for the activation of phenylacetic acid; five ORFs encoding the subunits of a ring hydroxylation multienzymatic system ( paaGHIJK ); the gene paaW encoding a membrane protein of unknown function; …

WebThe first reaction is the decarboxylative condensation of 4-hydroxyphenylpropionyl-CoA as the starter substrate with one molecule of malonyl-CoA to form the 4-hydroxyphenyl-propionyl-β-diketide-CoA intermediate, which is released from the active site and nonenzymatically hydrolyzed for conversion into a 4-hydroxyphenyl-propionyl-β-diketide …

WebJul 21, 2010 · Phenylacetyl-CoA is the substrate of a presumed multicomponent oxygenase, PaaABCDE. This oxygenase is a key enzyme of the pathway, proposed to be responsible … osce ficha rnpWebLocus tag: b1398 Name: paaK Funciton: phenylacetyl-CoA ligase paaA-paaB-paaC-paaD-paaE-paaF-paaG-paaH-paaI-paaJ-paaK-97: 4.3: ATTTGTGATTTTACTTAACTAT: b1388-76: 3.6: TTGTGTAACTTTCATAAAACAA-45: 3.6: TGTTTTTAATTAATTCACGAAA: Serratia proteamaculans 568 osce fraccionamientoWebPhenylacetate is first converted to phenylacetyl-CoA by phenylacetate-CoA ligase. De-aromatization of the ring is achieved by activation of phenylacetyl-CoA to the highly … osce implementation sampleWebAug 24, 2007 · A novel phenylacetyl-CoA ligase gene, designated phlB, was cloned and identified from the penicillin producing strain Penicillium chrysogenum based on … osc/e infanterieWebMay 31, 2011 · A novel phenylacetic acid (PAA)-induced CoA-ligase-encoding gene, designated as phlC, has been cloned from penicillin-producing fungus Penicillium … osceia aprendizWebThe genome of this bacterium has a high GC content similar to that of P. hirschii, it can use phenylacetic acid as a carbon and energy source and the first step in phenylacetate catabolism involves a phenylacetyl-CoA ligase (21, 22). Finally, P. putida F1 does not have its own luxI homolog. osce ingresarWebIn enzymology, a phenylacetate—CoA ligase is an enzyme (EC 6.2.1.30) that catalyzes the chemical reaction. ATP + phenylacetate + CoA AMP + diphosphate + phenylacetyl-CoA. … osce contraception counselling